Free Access
Table II.
Primers used in this study were designed from F. johnsoniae 17061T. All Fjoh primers are based on the mexB homolog sequences with the exception of Fjoh_4299 and Fjoh_4301, which are based on the mexA and oprM homolog sequences.
| Name | Sequence | Target | Reference |
|---|---|---|---|
| 27F | AGAGTTTGATCCTGGCTCAG | 16S rRNA | [20] |
| 1392R | GACGGGCGGTGTGTAC | 16S rRNA | [20] |
| 16SR | TAGCACGTGTGTAGCCCAAG | 16S rRNA, for qRT-PCR | This study |
| 16SF | CGCAACCCCTGTTGTTAGTT | 16S rRNA, for qRT-PCR | This study |
| T3 | AATTAACCCTCACTAAAGG | PBK-CMV plasmid insert | [41] |
| T7 | GTAATACGACTCACTATAGGGC | PBK-CMV plasmid insert | [41] |
| 0907R | TCAGGCACCGTCAAATTGTA | Fjoh_0907 | This study |
| 0907F | TTTGGCGCGTATAAAAGGAG | Fjoh_0907 | This study |
| 4131R | AAGAAGCCCGATAAGCATGA | Fjoh_4131 | This study |
| 4131F | TCGATTCCGTTTGGATTAGC | Fjoh_4131 | This study |
| 4300R | CCATTTCGCCTGTTTTGTTT | Fjoh_4300 | This study |
| 4300F1 | CGCACAGGCATCTGACTTTA | Fjoh_4300 | This study |
| 4300F2 | CCAACTGTTCCCGGATTTAG | Fjoh_4300 | This study |
| 4299R | TGTCAAGGTTTCCGCTTACC | Fjoh_4299 | This study |
| 4299F | TCCCGAGAATGCCAGAATAC | Fjoh_4299 | This study |
| 4301R | TTGCTTGTGCTTGCGTTTAC | Fjoh_4301 | This study |
| 4301F | AACCAAAATCGTGACCTTCG | Fjoh_4301 | This study |
| 3239R | CAGAATCGTTCCGTCTGGAT | Fjoh_3239 | This study |
| 3239F | GATCCGGACAGCTTGACAAT | Fjoh_3239 | This study |
| 4862R | GCACTTTGTGCGATGATGTT | Fjoh_4862 | This study |
| 4862F | CGATTTTGGCCAATACATTT | Fjoh_4862 | This study |
| CFLR | ACAGCTTCCGATAGCCTGAA | Cfl/Bcr efflux pump | This study |
| CFLF | AACCGCTCTTGGTCCTTTTT | Cfl/Bcr efflux pump | This study |