Free Access
Table I.
Bacterial strains, plasmids and primers used in this study.
| Strain or plasmid | Description | Reference or source |
|---|---|---|
| Strains | ||
| S. aureus subsp. anaerobius | ||
| MVF-84 (CECT 7640) | Clinical isolate from a 4-month-old lamb affected by abscess disease | Our laboratory |
| RDKA84 | Catalase-positive mutant of MVF-84 | This study |
| S. aureus | ||
| ATCC 12600 | Type strain | |
| RN4220 | Restriction-deficient mutant of S. aureus 8325-4 | [18] |
| MN-42 | Clinical isolate from ovine gangrenous mastitis | Our laboratory |
| MN-45 | Clinical isolate from ovine gangrenous mastitis | Our laboratory |
| MN-73 | Clinical isolate from ovine gangrenous mastitis | Our laboratory |
| DGA-1 | Clinical isolate from acute bovine mastitis | Our laboratory |
| E. coli | ||
| DH5α | Cloning host strain | Our laboratory |
| TOP10 | Cloning host strain | Invitrogen |
| Plasmids | ||
| pBT2 | E. coli–Staphylococcus amp cat shuttle vector | [4] |
| pCR2.1 | T-vector for cloning of PCR products | Invitrogen |
| pE194 | Temperature-sensitive erm vector for allelic exchange in S. aureus | [14] |
| pLUG277 | Recombinogenic plasmid used in the construction of the catalase-positive mutant of MVF-84 (pE194 inserted with a 2 kb HindIII-SacI fragment containing the katA gene) | This study |
| Primers | ||
| Cat1 | TATAAATTGTGGAGGGATGAT | [25] |
| Cat2 | TCATAAACTGCTCAACTACGC | [25] |